View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_66 (Length: 268)
Name: NF0780_low_66
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_66 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 10979602 - 10979736
Alignment:
| Q |
1 |
agagttggaaagaaagagaaagttacaaatccattcagatgaaacgatgattcatatttctctgattaccattgatttgaagaagaagagatacaacatt |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
10979602 |
agagttggaaagaaagaaaaagttacaaatccattcagatgaaacgatgattcatatt--tctgattaccattgattt---gaagaagagatagaacatt |
10979696 |
T |
|
| Q |
101 |
attgcttcagctaacgtattggttcaggattctcatcaca |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10979697 |
attgcttcagctaacgtattggttcaggattctcatcaca |
10979736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6950 times since January 2019
Visitors: 5773