View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_67 (Length: 267)
Name: NF0780_low_67
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 46 - 104
Target Start/End: Original strand, 30249919 - 30249977
Alignment:
Q |
46 |
actcccgtcatgatccaatagagtatagttagacaaagacattagacaaattttccaca |
104 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30249919 |
actcccgtcatgatccaatagagtatagttagacaaagacattagacaaattttccaca |
30249977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6162 times since January 2019
Visitors: 5762