View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_68 (Length: 267)
Name: NF0780_low_68
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_68 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 25 - 218
Target Start/End: Original strand, 5396496 - 5396689
Alignment:
Q |
25 |
agataatactaaaagattgtttgtcgtatgttataaacaaggttgaatacttacattttgaaccctaatcgtcaactgaaaacgaattcaagctataaaa |
124 |
Q |
|
|
||||| ||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | |
|
|
T |
5396496 |
agatagtactaaaagattgcttgtcgtatgttgtaaacaaggttgaatacttacattttgaaccctaatcatcaactgaaaacgaattcaagctataaga |
5396595 |
T |
 |
Q |
125 |
atataagtgtatcttccatgcttatttttctttaaatttcaacaatgtagtcacatttcaattctaagttattttctggtatgaacgtttttgc |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
5396596 |
atataagtgtatcttccatgcttatttttctttaaatttcaacaatgtagtcacatttcaattctaagttattttctggtgtgaacgtttttgc |
5396689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University