View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0780_low_69 (Length: 266)

Name: NF0780_low_69
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0780_low_69
NF0780_low_69
[»] chr4 (1 HSPs)
chr4 (46-104)||(30249919-30249977)


Alignment Details
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 46 - 104
Target Start/End: Original strand, 30249919 - 30249977
Alignment:
46 actcccgtcatgatccaatagagtatagttagacaaagacattagacaaattttccaca 104  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30249919 actcccgtcatgatccaatagagtatagttagacaaagacattagacaaattttccaca 30249977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6715 times since January 2019
Visitors: 5770