View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_70 (Length: 265)
Name: NF0780_low_70
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 29 - 214
Target Start/End: Complemental strand, 44693967 - 44693782
Alignment:
| Q |
29 |
aaaaagaaccctgaaatgcaagcaaaccttcagattctgagggacaaaattgtgtactctcctctcgatatttttatttatttagcaagcatttttcttt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44693967 |
aaaaagaaccctgaaatgcaagcaaaccttcagattctgagggacaaaattgtgtactctcctctcgatatttttatttgcttagcaagcatttttcttt |
44693868 |
T |
 |
| Q |
129 |
tgtgcaaaaacgtgaggtacaaaaccatataacatactgaagcagggttacactactaaactcacaaacctaacccatcagtgaac |
214 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44693867 |
tgtgcaaaaatgtgaggtacaaaaccatataacatactgaagcagggttacactactaaactcacaaacctaacccatcagagaac |
44693782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 44633928 - 44633877
Alignment:
| Q |
29 |
aaaaagaaccctgaaatgcaagcaaaccttcagattctgagggacaaaattgt |
81 |
Q |
| |
|
||||||||| ||| |||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
44633928 |
aaaaagaacactggaatgcaagcaaaccttcatattc-gagggacaaaattgt |
44633877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 61
Target Start/End: Complemental strand, 44693636 - 44693604
Alignment:
| Q |
29 |
aaaaagaaccctgaaatgcaagcaaaccttcag |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44693636 |
aaaaagaaccctgaaatgcaagcaaaccttcag |
44693604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University