View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_73 (Length: 255)
Name: NF0780_low_73
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_73 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 49 - 243
Target Start/End: Original strand, 473788 - 473974
Alignment:
| Q |
49 |
taaataaacgtgcaatcgtgtttggagagcataagaactttagtttacttcaacaaaaaataataataataaagcctaggattgcatatataaataaggt |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
473788 |
taaataaacgtgcaatcgtgtttggagagcataagaactttagtttacttcaacaaaaaataataataaaaaagcctaggattgtatatataaataaggt |
473887 |
T |
|
| Q |
149 |
ttacc--atctctttatattcacccnnnnnnnnnnnnnnnnnnnctttgagcaacgtgttttggaaagcaaagatgggatgtttagacatggagtat |
243 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
473888 |
ttaccatatctctttatattcaccc----------aaaaaaaaactttgagcaacgtgttttggaaagcaaagatgggatgtttagacatggagtat |
473974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 206 - 242
Target Start/End: Original strand, 479411 - 479447
Alignment:
| Q |
206 |
tttggaaagcaaagatgggatgtttagacatggagta |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
479411 |
tttggaaagcaaagatgggatgtttagacatggagta |
479447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5178 times since January 2019
Visitors: 5755