View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_75 (Length: 254)
Name: NF0780_low_75
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_75 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 73 - 176
Target Start/End: Complemental strand, 10098492 - 10098390
Alignment:
| Q |
73 |
ttaaacactcagcgccaaacaataataaaaacctaatgttgctttcatatcactttcaaagatccatgaatggattcacattttttacacaaacatttgt |
172 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10098492 |
ttaaacactcaatgccaaacaataataaaaac-taatgttgctttcatatcactttcaaagatccatgaatggattcacattttttacacaaacatttgt |
10098394 |
T |
 |
| Q |
173 |
tcat |
176 |
Q |
| |
|
|||| |
|
|
| T |
10098393 |
tcat |
10098390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University