View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_78 (Length: 248)
Name: NF0780_low_78
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_78 |
 |  |
|
[»] scaffold0070 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 95 - 224
Target Start/End: Original strand, 7247255 - 7247384
Alignment:
Q |
95 |
ctgcacctgcctttgttgttgctgctgctgcccttgtctctgacatcttttacagaaattcataaactaatgtacaaagaaaaaattaaattcaaatgca |
194 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
7247255 |
ctgcacctgcctttgttgttgctgctgctgcccttgtctctgacatcttttacacaaattcataaactaatgtacaaagaaaaaattaaatgcaaatgca |
7247354 |
T |
 |
Q |
195 |
tgttagtccatgcacctttggttttgctgt |
224 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
7247355 |
tgttagtccatgcacctttggttttgctgt |
7247384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 120 - 215
Target Start/End: Complemental strand, 25321474 - 25321379
Alignment:
Q |
120 |
tgctgcccttgtctctgacatcttttacagaaattcataaactaatgtacaaagaaaaaattaaattcaaatgcatgttagtccatgcacctttgg |
215 |
Q |
|
|
||||||| |||||||| |||||||||||| ||||||| || |||||||||| ||||| | || |||||||||||||| |||||| ||||||||| |
|
|
T |
25321474 |
tgctgcctttgtctctaacatcttttacaaaaattcactaataaatgtacaaataaaaactaaatttcaaatgcatgttggtccattcacctttgg |
25321379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 30249919 - 30249977
Alignment:
Q |
21 |
actcccgtcatgatccaatagagtatagttagacaaagacattagacaaattttccaca |
79 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30249919 |
actcccgtcatgatccaatagagtatagttagacaaagacattagacaaattttccaca |
30249977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 120 - 215
Target Start/End: Original strand, 18409 - 18505
Alignment:
Q |
120 |
tgctgcccttgtctctgacatctttt-acagaaattcataaactaatgtacaaagaaaaaattaaattcaaatgcatgttagtccatgcacctttgg |
215 |
Q |
|
|
||||||| ||||| |||||||||||| ||| ||||||| || |||||||||||||||| | || |||||||||||||| |||||| ||||||||| |
|
|
T |
18409 |
tgctgcctttgtcactgacatctttttacaaaaattcacaaggaaatgtacaaagaaaaactaaatttcaaatgcatgttggtccattcacctttgg |
18505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University