View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_81 (Length: 234)
Name: NF0780_low_81
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_81 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 45654554 - 45654625
Alignment:
| Q |
1 |
taaacaatagaaacttttatgatttcatctcatttctttctattaacacaaacatttaatgtgattcttttt |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45654554 |
taaacaatagaaacttttatgatttcatctcatttctttctattaacacaaacatttaatgtgattcttttt |
45654625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6732 times since January 2019
Visitors: 5771