View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_82 (Length: 234)
Name: NF0780_low_82
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0780_low_82 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 2293308 - 2293166
Alignment:
Q |
1 |
aaatctctactgatatgtgtatacttgtagttcgaacgaaccaaaagatatggcatgtcatcgggataagacatcggaaaaacttgaattttacatcact |
100 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2293308 |
aaatctctactgatatgtgtacacttgtagttcgaacgaaccaaaagatatggcatgtcatcgggataagacatcggaaaaacttgaattttacatcact |
2293209 |
T |
 |
Q |
101 |
ttcatccataagaatcttaggatggtaaacaatagttcatttg |
143 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2293208 |
ttcatccataagaatcttaggatggtaaacaatagttcatttg |
2293166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University