View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0780_low_86 (Length: 223)

Name: NF0780_low_86
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0780_low_86
NF0780_low_86
[»] chr1 (1 HSPs)
chr1 (1-111)||(45597241-45597351)


Alignment Details
Target: chr1 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 45597351 - 45597241
Alignment:
1 ggtggtacgattagaagcttccatctccgcaccacctctcccatgtccttcaatgttgtgtcgagagcttctccttgatttgcattatattctcacgatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
45597351 ggtggtacgattagaagcttccatctccgcaccacctctcccatgtccttcgatgttgtgtcgagagcttctccttgatttgcattatattctcacgatg 45597252  T
101 cgaggttcata 111  Q
    |||||||||||    
45597251 cgaggttcata 45597241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University