View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_87 (Length: 220)
Name: NF0780_low_87
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_87 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 20628959 - 20628812
Alignment:
| Q |
1 |
aaacactgcatgaattctcagtaattttctgatcaattttagcatcatcacttttatcatgcttggcttgtatagttggcgaacgcaccctcgcatgagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20628959 |
aaacactgcatgaattctcagtaattttctgatcaattttagcatcatcacttttatcatgcttggcttgtatagttggcgaacgcaccctcgcatgagg |
20628860 |
T |
|
| Q |
101 |
cctaattcgattcaagcaaaaacctggtaaccttgctcctctcttgcc |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20628859 |
cctaattcgattcaagcaaaaacctggtaaccttgctcctctcttgcc |
20628812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7096 times since January 2019
Visitors: 5774