View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_92 (Length: 218)
Name: NF0780_low_92
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_92 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 43601951 - 43602040
Alignment:
| Q |
1 |
gttccacttgacaataatttgcagtctgtcacgtgcatcacgtgccagagctattaatttatagaattgttatccacttaacttaaccag |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43601951 |
gttccacttgacaataatttgcagtctgtcacgtgcatcacgtgccagagctattaatttatagaatcgttatccacttaacttaaccag |
43602040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 22436263 - 22436220
Alignment:
| Q |
1 |
gttccacttgacaataatttgcagtctgtcacgtgcatcacgtg |
44 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
22436263 |
gttccaattgacaataatttgcggtctgtcacatgcatcacgtg |
22436220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University