View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0780_low_92 (Length: 218)

Name: NF0780_low_92
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0780_low_92
NF0780_low_92
[»] chr8 (1 HSPs)
chr8 (1-90)||(43601951-43602040)
[»] chr2 (1 HSPs)
chr2 (1-44)||(22436220-22436263)


Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 43601951 - 43602040
Alignment:
1 gttccacttgacaataatttgcagtctgtcacgtgcatcacgtgccagagctattaatttatagaattgttatccacttaacttaaccag 90  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
43601951 gttccacttgacaataatttgcagtctgtcacgtgcatcacgtgccagagctattaatttatagaatcgttatccacttaacttaaccag 43602040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 22436263 - 22436220
Alignment:
1 gttccacttgacaataatttgcagtctgtcacgtgcatcacgtg 44  Q
    |||||| ||||||||||||||| ||||||||| |||||||||||    
22436263 gttccaattgacaataatttgcggtctgtcacatgcatcacgtg 22436220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University