View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0780_low_96 (Length: 213)

Name: NF0780_low_96
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0780_low_96
NF0780_low_96
[»] chr8 (2 HSPs)
chr8 (36-116)||(7247228-7247308)
chr8 (160-192)||(7247352-7247384)


Alignment Details
Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 36 - 116
Target Start/End: Original strand, 7247228 - 7247308
Alignment:
36 gaacctgtgatgcttctgnnnnnnnctctgcacctgcctttgttattgctgctgctgcccttgtctctgacatcatttaca 116  Q
    ||||||||||||||||||       ||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||    
7247228 gaacctgtgatgcttctgtttttttctctgcacctgcctttgttgttgctgctgctgcccttgtctctgacatcttttaca 7247308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 192
Target Start/End: Original strand, 7247352 - 7247384
Alignment:
160 gcatgttagtccaagcacctttggttttgctgt 192  Q
    ||||||||||||| |||||||||||||||||||    
7247352 gcatgttagtccatgcacctttggttttgctgt 7247384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University