View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_96 (Length: 213)
Name: NF0780_low_96
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_96 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 36 - 116
Target Start/End: Original strand, 7247228 - 7247308
Alignment:
| Q |
36 |
gaacctgtgatgcttctgnnnnnnnctctgcacctgcctttgttattgctgctgctgcccttgtctctgacatcatttaca |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7247228 |
gaacctgtgatgcttctgtttttttctctgcacctgcctttgttgttgctgctgctgcccttgtctctgacatcttttaca |
7247308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 192
Target Start/End: Original strand, 7247352 - 7247384
Alignment:
| Q |
160 |
gcatgttagtccaagcacctttggttttgctgt |
192 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
7247352 |
gcatgttagtccatgcacctttggttttgctgt |
7247384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7114 times since January 2019
Visitors: 5774