View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0780_low_98 (Length: 212)
Name: NF0780_low_98
Description: NF0780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0780_low_98 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 14 - 135
Target Start/End: Original strand, 26529953 - 26530074
Alignment:
| Q |
14 |
atatatatatgaaaatacaaataaccccatgtgcatcaaaccaaataaataactgtttgcatgtgattgggcgtttctacacgatatgaagatgcaaatc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26529953 |
atatatatatgaaaatacaaataaccccatgtgcatcaaaccaaataaataactgtttgcatgtgattgggcgtttctacaggatatgaagatgcaaatc |
26530052 |
T |
|
| Q |
114 |
atctcaaatacctacctatgct |
135 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
26530053 |
atctcaaatacctaccaatgct |
26530074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6118 times since January 2019
Visitors: 5762