View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0781_high_10 (Length: 268)
Name: NF0781_high_10
Description: NF0781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0781_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 42 - 243
Target Start/End: Complemental strand, 40461125 - 40460924
Alignment:
| Q |
42 |
tcatcagttcacatgctatatacttttacaatttgggttagcgtccatacgtaggtttgtgggattgtgcatgttctgtgtgggtgtttggctccaaatt |
141 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40461125 |
tcatcagttcacatactatatacttttacaatttgggttagcgtccatacgtaggtttgtgggattgtgcatgttatgtgtgggtgtttggctccaaatt |
40461026 |
T |
|
| Q |
142 |
tggatttgtgtatcaggtttttatttctttacccttcaaggttatactgaattacctatttagttaatttgtttttgcttctacaaggtatgatttcatc |
241 |
Q |
| |
|
|| || ||| |||||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
40461025 |
tgaatctgtttatcaggtttttatttctttacccttcagggttatattatattacctatttagttaatttgtttttgcttttacaaggtatgattttatc |
40460926 |
T |
|
| Q |
242 |
tc |
243 |
Q |
| |
|
|| |
|
|
| T |
40460925 |
tc |
40460924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7155 times since January 2019
Visitors: 5774