View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0781_high_15 (Length: 206)
Name: NF0781_high_15
Description: NF0781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0781_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 8 - 108
Target Start/End: Complemental strand, 18030062 - 18029962
Alignment:
Q |
8 |
ttggtttaataattgaaggacaaatttgatgagagaatgatatttgggactaaattgaaagtttattcaaatctaaaacaagcattaaagtttggaaata |
107 |
Q |
|
|
||||||| |||||| |||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18030062 |
ttggtttgataattaaaggactaaattgatgagagaatgatatttgggactaaattgaaagtttattcaaatctaaaacaagcattaaagtttggaaata |
18029963 |
T |
 |
Q |
108 |
a |
108 |
Q |
|
|
| |
|
|
T |
18029962 |
a |
18029962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7002 times since January 2019
Visitors: 5773