View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0781_high_7 (Length: 276)
Name: NF0781_high_7
Description: NF0781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0781_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 175
Target Start/End: Original strand, 2150681 - 2150863
Alignment:
Q |
1 |
catttccattgagcttcctttgtaacttcctaagagatttttcactc------tatatata-attaacattcaacacacacttcatcaca--attcacaa |
91 |
Q |
|
|
||||||||||||||||| || || |||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||| |||||||| |
|
|
T |
2150681 |
catttccattgagcttcgtt-gtttcttcctaagagatttttcactcactatatatatatatatcaacattcaacacacacttcatcacacaattcacaa |
2150779 |
T |
 |
Q |
92 |
ccttgtatatttttcactcacttttttgtctactcttctagcacaatggtccaatctcaacagtatgtgaattcctccttctca |
175 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2150780 |
ccttgtatatttttcactcacttttttgtctactcttctagcacaatggtccaatctcaacagtatgtgaattcctccttctca |
2150863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6731 times since January 2019
Visitors: 5771