View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0781_low_10 (Length: 372)
Name: NF0781_low_10
Description: NF0781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0781_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 9 - 283
Target Start/End: Original strand, 13910689 - 13910963
Alignment:
| Q |
9 |
aaccaattgttgaacatgtcaattcaactagttgagccgaccgattcgatttttaaaacattgttatatataataatttagtagaaaaatgcataatttg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13910689 |
aaccaattgttgaacatgtcaattcaactagttgagccggccgattcgatttttaaaacattgttatatatactaatttagtagaaaaatgcataattta |
13910788 |
T |
|
| Q |
109 |
ttaattgtgtatttatttattgatgaaggcaaggaaggttttgaatgagagtataaggaggataatagaaagaaggaaggagagcaggaattatggtgga |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13910789 |
ttaattgtttatttatttattgatgaaggcaaggaaggttttgaatgagagtataaggaggataatagaaagaaggaaggagagcaggaattatggtgga |
13910888 |
T |
|
| Q |
209 |
gggttgttaggaattctgttgagaggcagaggtgatgagaagatgtaccaactaactgattctcaagtggctgat |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13910889 |
gggttgttaggaattctgttgagaggcagaggtgatgagaagatgaaccaactaactgattctcaagtggctgat |
13910963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6634 times since January 2019
Visitors: 5769