View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0781_low_15 (Length: 331)
Name: NF0781_low_15
Description: NF0781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0781_low_15 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 110 - 331
Target Start/End: Original strand, 32528515 - 32528736
Alignment:
| Q |
110 |
gaaaatgcatgctctaattcacgtcatcatttcattcatgcatactcatttttccaataaataacagcttagttgaattacttgaagtaattcattccac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32528515 |
gaaaatgcatgctctaattcacgtcatcatttcatttatgcatactcatttttccaataaataacagcttagttgaattacttgaagtaattcattccac |
32528614 |
T |
 |
| Q |
210 |
gattctgtttggtgcacccactgtagtacgctctaacgagcaagaacaatgaatagcattgttgaattaagttttcaatttacatgacttatatttaaac |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32528615 |
gattctgtttggtgcacccactgtagtacgctctaacgagcaagaacaatgaatagcattgttgaattaagttttcaatttacatgacttatatttaaac |
32528714 |
T |
 |
| Q |
310 |
tgcatatatactgaaattcact |
331 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32528715 |
tgcatatatactgaaattcact |
32528736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University