View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0781_low_23 (Length: 273)
Name: NF0781_low_23
Description: NF0781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0781_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 45 - 188
Target Start/End: Original strand, 2466369 - 2466512
Alignment:
| Q |
45 |
gttttcaagatattttcatagttagttccatgtggacctgacattcttttccgataaaagactcgcacttcaaatgtgtatgggaactagctctctttgc |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2466369 |
gttttcaagatattttcatagttagttccatgtggacctgacattcttttcggataaaagactcgcacttcaaatgtgtatgggaactagctctctttgc |
2466468 |
T |
 |
| Q |
145 |
ataatcagaactccctagattgttaggctaggtttatgtagtcg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2466469 |
ataatcagaactccctagattgttaggctaggtttatgtagtcg |
2466512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University