View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0781_low_27 (Length: 260)
Name: NF0781_low_27
Description: NF0781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0781_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 22 - 223
Target Start/End: Complemental strand, 34943355 - 34943154
Alignment:
| Q |
22 |
aggggtctctctgagtgaagaactttgctttaaatgacatctttgtcgtgtacatttatgcttgctgtgacattctgttgcatagaaagtgacttgacat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34943355 |
aggggtctctctgagtgaagaactttgctttaaatgacatctttgtcgtgtacatttatgcttgctgtgacattctgttgcatagaaagtgacttgacat |
34943256 |
T |
 |
| Q |
122 |
gctcgtgagtcgatcctataatattgttgcctttgttagggtatgctttctttcctccaagcactatacttgatggtaacaattaacaaaattgtcattt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34943255 |
gctcgtgagtcgatcctataatattgttgcctttgttagggtatgctttctttcctccaagcactatacttgatggtaacaattaacaaaattgtcattt |
34943156 |
T |
 |
| Q |
222 |
ct |
223 |
Q |
| |
|
|| |
|
|
| T |
34943155 |
ct |
34943154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University