View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0781_low_36 (Length: 206)

Name: NF0781_low_36
Description: NF0781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0781_low_36
NF0781_low_36
[»] chr5 (1 HSPs)
chr5 (8-108)||(18029962-18030062)


Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 8 - 108
Target Start/End: Complemental strand, 18030062 - 18029962
Alignment:
8 ttggtttaataattgaaggacaaatttgatgagagaatgatatttgggactaaattgaaagtttattcaaatctaaaacaagcattaaagtttggaaata 107  Q
    ||||||| |||||| |||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18030062 ttggtttgataattaaaggactaaattgatgagagaatgatatttgggactaaattgaaagtttattcaaatctaaaacaagcattaaagtttggaaata 18029963  T
108 a 108  Q
    |    
18029962 a 18029962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University