View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0781_low_38 (Length: 202)
Name: NF0781_low_38
Description: NF0781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0781_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 32853229 - 32853111
Alignment:
| Q |
1 |
caatttgtaagtgaggaagctcatacaacaagtacttaaggtttttggtgaaaatgtggtgttgaaatcacttgtgtaattgctcttagtctaacctgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32853229 |
caatttgtaagtgaggaagctcatacaacaagtacttaaggtttttggtgaaaatgtggtgttgaaatcacttgtgtaattgctcttagtctaacctgat |
32853130 |
T |
 |
| Q |
101 |
tatcctgtgtttaaaggct |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32853129 |
tatcctgtgtttaaaggct |
32853111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University