View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0781_low_7 (Length: 428)
Name: NF0781_low_7
Description: NF0781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0781_low_7 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 331; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 94 - 428
Target Start/End: Complemental strand, 24229385 - 24229051
Alignment:
| Q |
94 |
gatgtcggattcaattccgacgccgacgaatctgttgttagggttagagaggaaggtgaagaggaaagtggggatggagggggaatggatgagttggaat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24229385 |
gatgtcggattcaattccgacgccgacgaatctgttgttagggttagagaggaaggtgaagaggaaagtggggatggagggggaatggatgagttggaat |
24229286 |
T |
 |
| Q |
194 |
ataagacagcggttgttggtgtagagttgaagagtggcggctgggttggattggccgcgttgggagtttggacgccattcgatgtcaaggccgatgattg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24229285 |
ataagacagcggttgttggtgtagagttgaagagtggcggctgggttggattggccgcgttgggagtttggacgccattcgatgtcaaggccgatgattg |
24229186 |
T |
 |
| Q |
294 |
cgggggagagggattgggtttcgaggagccaagattcgacgtggataggggaacaggtgaggagggtttggattgtgagggtggtgtcgatggtgatgga |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24229185 |
cgggggagagggattgggtttcgaggagccaagattcgacgtggatgggggaacaggtgaggagggtttggattgtgagggtggtgtcgatggtgatgga |
24229086 |
T |
 |
| Q |
394 |
gtaggtgttgtgggtgtcgtaggggaggtggttgt |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
24229085 |
gtaggtgttgtgggtgtcgtaggggaggtggttgt |
24229051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 355 - 428
Target Start/End: Original strand, 24225003 - 24225076
Alignment:
| Q |
355 |
gagggtttggattgtgagggtggtgtcgatggtgatggagtaggtgttgtgggtgtcgtaggggaggtggttgt |
428 |
Q |
| |
|
||||| ||||||||||| ||||| ||||| ||||||||||||||||| |||||| |||| ||||||| ||||| |
|
|
| T |
24225003 |
gagggattggattgtgaaggtggagtcgaaggtgatggagtaggtgtcgtgggtatcgtgagggaggttgttgt |
24225076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University