View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0781_low_8 (Length: 408)
Name: NF0781_low_8
Description: NF0781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0781_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 4e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 62 - 253
Target Start/End: Complemental strand, 27630449 - 27630258
Alignment:
| Q |
62 |
tgagatgtgatcaagagcacccatattgttgtatacgcgtttgatagaaatgataagtgataaactgttaatgttttgatagtgctgctacttacttaca |
161 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27630449 |
tgagatgtgatcaagagcacccatattgaagtatacgcgtttgatagaaatgataagtgataaactgttaatgttttgatagtgctgctacttacttaca |
27630350 |
T |
|
| Q |
162 |
ttctatatttatagagatgattgagtaaacaaagtctccgacaaagtagttaaggattcaaaatctcacacgtccacgtgtcatattgttgg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27630349 |
ttctatatttatagagatgattgagtaaacaaagtctccgacaaagtagttaaggattcaaaatcttacacgtccacgtgtcatattgttgg |
27630258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4632 times since January 2019
Visitors: 5751