View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0782_high_11 (Length: 403)
Name: NF0782_high_11
Description: NF0782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0782_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 3e-39; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 202 - 307
Target Start/End: Original strand, 2557473 - 2557587
Alignment:
Q |
202 |
ttattttgaactctgattgtgtaaaatagttgattgaatatgattaattttgcatgtttttg---------tatgattatgagaagattgagtagagttt |
292 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
2557473 |
ttattttgaactctgattgtgtaaaatagttgattgaatatgattaattttgcatgtttttgtgatatatctatgattatgagaagattgagtagagttt |
2557572 |
T |
 |
Q |
293 |
gattgtgctgatgat |
307 |
Q |
|
|
||||||||||||||| |
|
|
T |
2557573 |
gattgtgctgatgat |
2557587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 2 - 65
Target Start/End: Original strand, 2557267 - 2557330
Alignment:
Q |
2 |
caagattccatttcgattgttccaaaacaaaggttgtttctttaacactctttctatcaacttg |
65 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2557267 |
caagattccatttcgattgttccaaaacaaaggttgtttctttaacactctttctatcaacttg |
2557330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 131 - 161
Target Start/End: Original strand, 2557396 - 2557426
Alignment:
Q |
131 |
gttaagttctgattagtattcagatgaagtg |
161 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
2557396 |
gttaagttctgattagtattcagatgaagtg |
2557426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 109 times since January 2019
Visitors: 5777