View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0782_high_14 (Length: 361)
Name: NF0782_high_14
Description: NF0782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0782_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 56 - 348
Target Start/End: Original strand, 43854899 - 43855191
Alignment:
| Q |
56 |
ctcctaagatttgttgttcgcaatgtttatgttggtgagcacctttctaaaattggatattttatctttgtgaaatcgcaaatcttttctatgatgaata |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43854899 |
ctcctaagatttgttgttcgcaatgtttatgttggtgagcacctttctaaaattggatattttatctttgtgaaatcgcaaatcttttctatgatgaata |
43854998 |
T |
|
| Q |
156 |
gttgactcatattatgaattgtattttacaatcaatttgatggagatttcatgactgcatgactccattaatatgatttcgaggtctttttcttctactt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43854999 |
gttgactcatattatgaattgtattttacaatcaatttgatggagatttcatgactgcttgactccattaatatgatttcgaggtctttttcttctactt |
43855098 |
T |
|
| Q |
256 |
gnnnnnnnnnaatgaaattcaaaattgttatttgtattcacaatgtttttgattcagcattcacaatgtttgtgggcataaccttcccattct |
348 |
Q |
| |
|
| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43855099 |
gtttttttttaatgaaattcaaaattgctatttgtattcacaatgtttttgattcagcattcacaatgtttgtgggcataaccttcccattct |
43855191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 7 - 56
Target Start/End: Original strand, 51112922 - 51112971
Alignment:
| Q |
7 |
ccaaggccttcggtgattttctctttggcccactcaatccatgtctctgc |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51112922 |
ccaaggccttcggtgattttctctttggcccactcagtccatgtctctgc |
51112971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 159 times since January 2019
Visitors: 5777