View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0782_high_15 (Length: 347)
Name: NF0782_high_15
Description: NF0782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0782_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 30 - 341
Target Start/End: Original strand, 1831953 - 1832264
Alignment:
Q |
30 |
agttcttcataatgaagcatcatggctggtatggtatgcttcatgatcatgatgcatgattcaattttaacttattatatgatttttattgcaattgttt |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1831953 |
agttcttcataatgaagcatcatggctggtatggtatgcttcatgatcatgatgcatgattcaattttaacttattatatgatttttattgcaattgttt |
1832052 |
T |
 |
Q |
130 |
tattctaatcagcgataacattagttagggtttgattcctagacataatataaccatattcttgaatgtgtcaaacattgtcactatggtctttaaatct |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
1832053 |
tattctaatcagcgataacattagttagggtttgattcctagacataatataaccatattcttgaatgtgtcaaacattgtcactgtggtctttaaatct |
1832152 |
T |
 |
Q |
230 |
gtcaaatttacaaaaatattcatgaatatatctttctttagtgagtttgatccttgaatatctttcattagtcagtttaaccgtcgaatgttcatttccc |
329 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
1832153 |
gtcaaatttacaaaaatattcatgaatatatctttctttagtgagtttgatccttaaaaatctttcattagtcagtttaaccgtcgaatattcatttccc |
1832252 |
T |
 |
Q |
330 |
ttttcatctcac |
341 |
Q |
|
|
||||||| |||| |
|
|
T |
1832253 |
ttttcatttcac |
1832264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 283
Target Start/End: Complemental strand, 7713754 - 7713662
Alignment:
Q |
191 |
ttgaatgtgtcaaacattgtcactatggtctttaaatctgtcaaatttacaaaaatattcatgaatatatctttctttagtgagtttgatcct |
283 |
Q |
|
|
||||||||||||| |||||||||||| || || | | | ||||| || ||||||||||| ||||| |||||||||||| ||||||| |||| |
|
|
T |
7713754 |
ttgaatgtgtcaagcattgtcactataatccttgattgtatcaaaattgcaaaaatattcttgaatgtatctttctttaccgagtttggtcct |
7713662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University