View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0782_high_19 (Length: 264)

Name: NF0782_high_19
Description: NF0782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0782_high_19
NF0782_high_19
[»] chr5 (2 HSPs)
chr5 (103-210)||(25867339-25867446)
chr5 (42-81)||(25867466-25867505)


Alignment Details
Target: chr5 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 103 - 210
Target Start/End: Complemental strand, 25867446 - 25867339
Alignment:
103 aaatgaaaaatgatgaagaatactagtacgatgaagtgcaactgcagcaaataactgaagaaaacagctgagacaagtaagactaagaaagaacaagaga 202  Q
    |||||||||||||||||||||||||||||  ||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
25867446 aaatgaaaaatgatgaagaatactagtaccctgacgtgcaactgcagcaaataactgaggaaaacagctgagacaagtaagactaagaaagaacaagaga 25867347  T
203 ttatttac 210  Q
    ||||||||    
25867346 ttatttac 25867339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 81
Target Start/End: Complemental strand, 25867505 - 25867466
Alignment:
42 caattgtaatatgtatgatataacttgtaaaattatataa 81  Q
    ||||||||| |||||||||||||||||||||||||| |||    
25867505 caattgtaacatgtatgatataacttgtaaaattatgtaa 25867466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 7200 times since January 2019
Visitors: 5775