View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0782_low_18 (Length: 341)
Name: NF0782_low_18
Description: NF0782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0782_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 9e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 79 - 267
Target Start/End: Original strand, 48958959 - 48959147
Alignment:
| Q |
79 |
ttaggtttgattaaagggacatcatggatacgggtcgagttcaattatagagatgagacggattgtgtgcatcccctgtcttaaggcttgcctcttgttg |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48958959 |
ttaggtttgattaaagggacatcatggatacgggtcgagttcaattatagagatgaggcggattgtgtgcatcccctgtcttaaggcttgcctcttgttg |
48959058 |
T |
 |
| Q |
179 |
tgtgcatttgagtaagaaatgttgaacaagaatgatccaacctcaataatgtatcttggaagaaagtatatgcaaactttccttcttta |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48959059 |
tgtgcatttgagtaagaaatgttgaacaagaatgatccaacctcaataatgtatcttggaagaaagtatctgcaaactttccttcttta |
48959147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 7728181 - 7728120
Alignment:
| Q |
17 |
agaatattatgttaagaatagacttggtatgcctaattttaggtttatcaacttctaggaggtt |
80 |
Q |
| |
|
|||||| ||||| |||||||||||||| ||||||| | |||||||||||| | |||||||||| |
|
|
| T |
7728181 |
agaatactatgtaaagaatagacttgg--tgcctaactataggtttatcaattcctaggaggtt |
7728120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 7 - 86
Target Start/End: Complemental strand, 3562397 - 3562318
Alignment:
| Q |
7 |
tgtttatcatagaatattatgttaagaatagacttggtatgcctaattttaggtttatcaacttctaggaggttaggttt |
86 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3562397 |
tgtttatcagagaatattatgttaagaatagacttggtatgcctaattttaggtttatcaacttctaggaggttaggttt |
3562318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 17 - 67
Target Start/End: Complemental strand, 9748944 - 9748894
Alignment:
| Q |
17 |
agaatattatgttaagaatagacttggtatgcctaattttaggtttatcaa |
67 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
9748944 |
agaatattatgttaagaatagactaggtatgcctaactttaggtttatcaa |
9748894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 25 - 80
Target Start/End: Complemental strand, 34066119 - 34066064
Alignment:
| Q |
25 |
atgttaagaatagacttggtatgcctaattttaggtttatcaacttctaggaggtt |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
34066119 |
atgttaagaatagacttggtatgcctaattataggtttagcaatttctaggaggtt |
34066064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 11 - 80
Target Start/End: Original strand, 22934420 - 22934489
Alignment:
| Q |
11 |
tatcatagaatattatgttaagaatagacttggtatgcctaattttaggtttatcaacttctaggaggtt |
80 |
Q |
| |
|
||||| ||||| |||||| || ||| | ||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
22934420 |
tatcagagaattttatgtcaaaaatcgtcttggtatgcctaattttaggtttatcaatttttaggaggtt |
22934489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 34 - 80
Target Start/End: Complemental strand, 30039661 - 30039615
Alignment:
| Q |
34 |
atagacttggtatgcctaattttaggtttatcaacttctaggaggtt |
80 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
30039661 |
atagacttggtatgcctaactttaggtttatcaacttctaggtggtt |
30039615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 11 - 80
Target Start/End: Original strand, 23352368 - 23352437
Alignment:
| Q |
11 |
tatcatagaatattatgttaagaatagacttggtatgcctaattttaggtttatcaacttctaggaggtt |
80 |
Q |
| |
|
||||| ||||| |||||| || ||| | ||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
23352368 |
tatcagagaattttatgtcaaaaatcgtcttggtatgcctaattttaggtttatcaatttttaggaggtt |
23352437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 29 - 80
Target Start/End: Original strand, 17704529 - 17704580
Alignment:
| Q |
29 |
taagaatagacttggtatgcctaattttaggtttatcaacttctaggaggtt |
80 |
Q |
| |
|
|||||||||| || | ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17704529 |
taagaatagaattagcatgcctaattttaggtttatcaacttcgaggaggtt |
17704580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University