View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0782_low_19 (Length: 329)
Name: NF0782_low_19
Description: NF0782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0782_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 101 - 313
Target Start/End: Original strand, 44154747 - 44154959
Alignment:
| Q |
101 |
aaacacgcacaaattgaactaatcgtcatgatagaaagaacattattattaataaattaagcacgcaaacgaaatcaatcagagagaacaatgatgatac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44154747 |
aaacacgcacaaattgaactaatcgtcatgatagaaagaacattattattaataaattaagcacgcaaacgaaatcaatcagagagaacaatgatgatac |
44154846 |
T |
|
| Q |
201 |
cactgcgactgagaatctgtttctgctccctaagactcggattcaccattggaatttgaactacgaatatgttgttgcttctcacaaatattttgagttc |
300 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44154847 |
cactgcgactgagaatctgtttcggctccctcagactcggattcaccattggaatttgaactacgaatatgttgttgcttctcacaaatattttgagttc |
44154946 |
T |
|
| Q |
301 |
gtgagaatatttt |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44154947 |
gtgagaatatttt |
44154959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 112 - 201
Target Start/End: Original strand, 40899480 - 40899565
Alignment:
| Q |
112 |
aattgaactaatcgtcatgatagaaagaacattattattaataaattaagcacgcaaacgaaatcaatcagagagaacaatgatgatacc |
201 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
40899480 |
aattgaactaatcatcatgatagaa----cattattattaataaattaagcacgcaagtgaaaacaatcagagagaacaatgataatacc |
40899565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 153 - 195
Target Start/End: Complemental strand, 40894519 - 40894477
Alignment:
| Q |
153 |
taaattaagcacgcaaacgaaatcaatcagagagaacaatgat |
195 |
Q |
| |
|
||||||||||||||||| |||||||| |||| ||||||||||| |
|
|
| T |
40894519 |
taaattaagcacgcaaatgaaatcaaccagaaagaacaatgat |
40894477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6774 times since January 2019
Visitors: 5771