View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0782_low_21 (Length: 304)
Name: NF0782_low_21
Description: NF0782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0782_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 13 - 276
Target Start/End: Complemental strand, 4496309 - 4496054
Alignment:
| Q |
13 |
aatatcaaagatgagtaattttgcagagaaaaatataaaaaatatcaccttaaaggctttcacataacttttgtttacactaaatgtctaaatatataca |
112 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4496309 |
aatatcaaaaatgagtaattttgcagagaaaaatataaaaaatatcacctt--------tcacgtaacttttgtttacactaaatgtctaaatatataca |
4496218 |
T |
 |
| Q |
113 |
atgacaaacgtttgctcaaatcaataggtctagctagatggtgatggtgatattaatccagacttgcaatctcgtcgtgaatcgattagaaatttattta |
212 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4496217 |
atgacaaacgtttgctcaaatcaagaggtctagctagatggtgatggtgatattaatccagacttgcaatctcgtcgtgaatcgattagaaatttattta |
4496118 |
T |
 |
| Q |
213 |
tttacccttttcgcaatctgatcttgtgcctcctgttattacttgctaagtttatgataatttt |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4496117 |
tttacccttttcgcaatctgatcttgtgcctcctattattacttgctaagtttatgataatttt |
4496054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 108 - 250
Target Start/End: Original strand, 4483535 - 4483677
Alignment:
| Q |
108 |
atacaatgacaaacgtttgctcaaatcaataggtctagctagatggtgatggtgatattaatccagacttgcaatctcgtcgtgaatcgattagaaattt |
207 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4483535 |
atacaatcacaaacgtttgctcaaatcaagaggtctagctagatggtgatggtgatattaatccagacttgcaatctcgtcgtgaatcgattagaaataa |
4483634 |
T |
 |
| Q |
208 |
atttatttacccttttcgcaatctgatcttgtgcctcctgtta |
250 |
Q |
| |
|
||| |||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
4483635 |
attcatttacacttttcgcaatctggtcttgtgcctcctgtta |
4483677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 149 - 226
Target Start/End: Complemental strand, 4507255 - 4507178
Alignment:
| Q |
149 |
gatggtgatggtgatattaatccagacttgcaatctcgtcgtgaatcgattagaaatttatttatttacccttttcgc |
226 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4507255 |
gatggtgatggtgatgttaatccagacttgaaatctattcgtgaatcgattagaaagaaatttatttacccttttcgc |
4507178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 50 - 106
Target Start/End: Complemental strand, 4485837 - 4485781
Alignment:
| Q |
50 |
aaaaatatcaccttaaaggctttcacataacttttgtttacactaaatgtctaaata |
106 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||| | ||||||||||| |||||| |
|
|
| T |
4485837 |
aaaaatatcagcttagaggctttcacataacttttgctaacactaaatgtataaata |
4485781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University