View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0782_low_22 (Length: 276)
Name: NF0782_low_22
Description: NF0782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0782_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 55 - 242
Target Start/End: Original strand, 52744401 - 52744588
Alignment:
Q |
55 |
catactgccgaaataataaattaagtttcaacaatatagtgtacgataaagataatgcatgtccgttcaaaaataaataaataatgcatgtatcttgttc |
154 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52744401 |
catactgccggaataataaattaagtttcaacaatatagtgtatgataaagataatgcatgtccgttcaaaaataaataaataatgcatgtatcttgttc |
52744500 |
T |
 |
Q |
155 |
ttgtcttaacccaattttggattattggatgctgtagttttatattttcgggggcataattgcaacttcaggaaagccaagtactcag |
242 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52744501 |
ttgtcttaacccaattttggattattggatgctgtagttttatattttcgggggcataattgcaacttcaggaaagccaagtactcag |
52744588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University