View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0782_low_25 (Length: 266)
Name: NF0782_low_25
Description: NF0782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0782_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 26 - 222
Target Start/End: Original strand, 30786928 - 30787124
Alignment:
| Q |
26 |
attatactactagttaaaaagaccaagtgccatcaaaggttgctttctccatgtcttgacaccactaagataagaaatcaatgatcgccacatacctaaa |
125 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30786928 |
attatgctactagttaaaaagaccaagtgccatcaaaggttgctttctccatgtcttgacaccactaagataagaaatcaatgatcgccacatacctaaa |
30787027 |
T |
|
| Q |
126 |
gtttggttctgtcataggtaatgcttttaagatttaattatctannnnnnnctgtccttcttcctgtcatttttaacttttgactaagagttatttc |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30787028 |
gtttgtttctgtcataggtaatgcttttaagatttaattatctatttttttctgtccttcttcctgtcatttttaacttttgactaagagttatttc |
30787124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6142 times since January 2019
Visitors: 5762