View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0782_low_27 (Length: 264)
Name: NF0782_low_27
Description: NF0782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0782_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 103 - 210
Target Start/End: Complemental strand, 25867446 - 25867339
Alignment:
| Q |
103 |
aaatgaaaaatgatgaagaatactagtacgatgaagtgcaactgcagcaaataactgaagaaaacagctgagacaagtaagactaagaaagaacaagaga |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25867446 |
aaatgaaaaatgatgaagaatactagtaccctgacgtgcaactgcagcaaataactgaggaaaacagctgagacaagtaagactaagaaagaacaagaga |
25867347 |
T |
 |
| Q |
203 |
ttatttac |
210 |
Q |
| |
|
|||||||| |
|
|
| T |
25867346 |
ttatttac |
25867339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 42 - 81
Target Start/End: Complemental strand, 25867505 - 25867466
Alignment:
| Q |
42 |
caattgtaatatgtatgatataacttgtaaaattatataa |
81 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
25867505 |
caattgtaacatgtatgatataacttgtaaaattatgtaa |
25867466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University