View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0782_low_28 (Length: 256)
Name: NF0782_low_28
Description: NF0782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0782_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 21 - 158
Target Start/End: Original strand, 13910425 - 13910562
Alignment:
Q |
21 |
catcatcatgtaattcaagtctannnnnnnatactcaactatatatcaatatttttaaaatcggacaacaaattgaaccactaaaacctccaattcatga |
120 |
Q |
|
|
|||||| |||||||||||||||| |||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
13910425 |
catcattatgtaattcaagtctatttttttatactcaactttatatcaatatttttaaaatgggacaacaaattgaaccactaaaacctccaattcatga |
13910524 |
T |
 |
Q |
121 |
tttaattgattcagtcgattttaactatagttgaaccg |
158 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
13910525 |
tttaattgattcagtcgattttaactatagttgaaccg |
13910562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 223 - 256
Target Start/End: Original strand, 13910625 - 13910658
Alignment:
Q |
223 |
ctagttgaaccaaccgcggttagaccagttcaac |
256 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| |
|
|
T |
13910625 |
ctagttgaaccaaccgcggtgagaccagttcaac |
13910658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7139 times since January 2019
Visitors: 5774