View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0782_low_30 (Length: 251)
Name: NF0782_low_30
Description: NF0782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0782_low_30 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 30 - 251
Target Start/End: Original strand, 13503495 - 13503715
Alignment:
| Q |
30 |
gtatcaatatttctaaaattttaaattgttgtttcttagtaatacaaagtaatggttacatgcatcacatgacggaaaatacacaacctcgtcttattat |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13503495 |
gtatcaatatttctaaaattttaaattgttgtttcttagtaatacaa-gtaatggttacatgcatcacatgacggaaaatacacaacctcgtcttattat |
13503593 |
T |
 |
| Q |
130 |
taaaattagatttgaacaatgtagattacatcgtcatctctttccaatcacaaacacccaagtgagttattacacatgaaaatgcaagtagtaggcaaca |
229 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13503594 |
taaaagtagatttgaacaatgtagattacatcgtcatctctttccaatcacaaacacccaagtgagttattacacatgaaaatgcaagtagtaggcaaca |
13503693 |
T |
 |
| Q |
230 |
aaggagaagatagaggcaccaa |
251 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
13503694 |
aaggagaagatagaggcaccaa |
13503715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University