View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0782_low_31 (Length: 251)
Name: NF0782_low_31
Description: NF0782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0782_low_31 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 25 - 251
Target Start/End: Original strand, 23204219 - 23204446
Alignment:
| Q |
25 |
gctgaggcaaatcggccattgtcttttgaccactactaatcatcttaacctattcttcttcnnnnnnnn-tcaccttaacctatttgccttacacttcag |
123 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| || |
|
|
| T |
23204219 |
gctgaggcaaatcaatcattgccttttgaccactactaatcatcttaacctattcttcttcaaaaaaaaatcaccttaacctattttccttacacttaag |
23204318 |
T |
 |
| Q |
124 |
tacttgcgagatatcatggcatgattcaacacaaggaaataccttttatattttttaagggcaaacttgaaggaggggattcaacccagtatacagacat |
223 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23204319 |
tacttgtgagatatcatggcatgattcaacacaaggaaatatcttttatattttttaagggcaaacttgaaggaggggattcaacccagtatacagacat |
23204418 |
T |
 |
| Q |
224 |
atcatgtatggataccaaaacatcacat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
23204419 |
atcatgtatggataccaaaacatcacat |
23204446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University