View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0782_low_34 (Length: 248)
Name: NF0782_low_34
Description: NF0782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0782_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 30 - 150
Target Start/End: Complemental strand, 37248960 - 37248840
Alignment:
| Q |
30 |
ggatataaggttggtttgatggctcgagtgggaggttaaagagccgtgtgatgaggacatcgattgttcaatgattttcatcactagttctatgaagggc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
37248960 |
ggatataaggttggtttgatggctcgagtgggagtttaaagagccgagtgatgaggacgtcgattgttcaatgactttcatcactagttctattaagggc |
37248861 |
T |
 |
| Q |
130 |
ttgatttagtttgacttcttt |
150 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37248860 |
ttgatttagtttgacttcttt |
37248840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 30 - 150
Target Start/End: Original strand, 28300516 - 28300636
Alignment:
| Q |
30 |
ggatataaggttggtttgatggctcgagtgggaggttaaagagccgtgtgatgaggacatcgattgttcaatgattttcatcactagttctatgaagggc |
129 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
28300516 |
ggatataagattggtttgatggctagagtgggaggttaaagagccgagtgatgaggatgtcgattgttcaatgaatttcatcactagttctattaagggc |
28300615 |
T |
 |
| Q |
130 |
ttgatttagtttgacttcttt |
150 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28300616 |
ttgatttagtttgacttcttt |
28300636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 197 - 242
Target Start/End: Complemental strand, 51112967 - 51112922
Alignment:
| Q |
197 |
agacatggactgagtgggccaaagagaaaatcaccgaaggccttgg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51112967 |
agacatggactgagtgggccaaagagaaaatcaccgaaggccttgg |
51112922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University