View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0782_low_35 (Length: 246)
Name: NF0782_low_35
Description: NF0782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0782_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 55 - 220
Target Start/End: Complemental strand, 17578309 - 17578144
Alignment:
| Q |
55 |
gctcctcccattccaaccgccacaacaacctccctctccgtcgccgccgttctaaccgtatctccgctgtcgccaccgatcctaaacctgctcctgtcac |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17578309 |
gctcctcccattccaaccgccacaacaacctccctctccgtcgccgccgttctaaccgtatctccgctgtcgccaccgatcctaaacctgctcccgtcac |
17578210 |
T |
 |
| Q |
155 |
taccgtcaacggttcttcttcaaggtctccgcctgccaaacctgtcaacggtgtctctggggtaaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17578209 |
taccgtcaacggttcttcttcaaggtctccgcctgccaaacctgtcaacggtgtctctggggtaaa |
17578144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 7 - 56
Target Start/End: Original strand, 51112922 - 51112971
Alignment:
| Q |
7 |
ccaaggccttcggtgattttctctttggcccactcagtccgtgtctctgc |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51112922 |
ccaaggccttcggtgattttctctttggcccactcagtccatgtctctgc |
51112971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University