View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0782_low_5 (Length: 496)
Name: NF0782_low_5
Description: NF0782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0782_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 319; Significance: 1e-180; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 96 - 474
Target Start/End: Complemental strand, 33615622 - 33615249
Alignment:
Q |
96 |
ggttgggacgctcataattagaaatgggaaaactaatttataggccaaggggttgcacatgcatgcatgtttgtcttttgctaaatggaactatttggat |
195 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33615622 |
ggttgggacgctcataattagaaatggggaaactaatttataggccaaggggttgcacatgcatgcatgtttgtcttttgctaaatggaactatttggat |
33615523 |
T |
 |
Q |
196 |
tagaagttagagcatactataggatgattatattattgtttttctataaagtatttgtagttttgttttcaaagggtccaacgacgaaacttgtatagac |
295 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||||| |
|
|
T |
33615522 |
tagaagttagagcatactataggatgattat-----tgtttttctataaagtatttgtagttttgtttttaaaggctccaacgacgaaactcatatagac |
33615428 |
T |
 |
Q |
296 |
actaagtgcttagaagtaaaaaattgtggattcaaacctacacctcatcacatcaaatgtttatatatatcttttaatcatatgagtcgagatgacattt |
395 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
T |
33615427 |
actaagtgcttagaagtaaaaaattgtggattcgaacctacacctcatcacatcaaatgtttatacatatattttaattatatgagtcgagatgacattt |
33615328 |
T |
 |
Q |
396 |
tttgtttgctaactcactgtaactagaacctttgacttgcgctccaagatatccccacaactttgatcttataggcccg |
474 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33615327 |
tttgtttgctaactcaccgtaactagaacctttgacttgcgctccaagatatccccacaactttgatcttataggcccg |
33615249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 50 - 98
Target Start/End: Complemental strand, 33615698 - 33615650
Alignment:
Q |
50 |
atctacctctaaggttctaaaatatagcaccaaacttaactttatgggt |
98 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33615698 |
atctacctttaaggttctaaaatatagcaccaaacttaactttatgggt |
33615650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5547 times since January 2019
Visitors: 5757