View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0783-Insertion-13 (Length: 301)
Name: NF0783-Insertion-13
Description: NF0783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0783-Insertion-13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 7 - 118
Target Start/End: Original strand, 17115939 - 17116049
Alignment:
Q |
7 |
attttattatcctacatgtgttttcaattttgatttcaaatgttattgtttgatatttttgtttcccttttcgtgaaagcttctgcgatagcatcattct |
106 |
Q |
|
|
|||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17115939 |
attttattatcctacaagt-ttttcaattttgatttcaaatgttattgtttgatatttttgtttcccttttcgtgaaagcttctgcgatagcatcattct |
17116037 |
T |
 |
Q |
107 |
cattccaatttt |
118 |
Q |
|
|
|||||||||||| |
|
|
T |
17116038 |
cattccaatttt |
17116049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 102 - 184
Target Start/End: Original strand, 17116069 - 17116151
Alignment:
Q |
102 |
attctcattccaattttaaacttctgtgaaaagaatacatatttcaactagccttcttatttgtttatttagtagcactcaca |
184 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||| |
|
|
T |
17116069 |
attctcattccaatttcaaacttctgtgaaaagaatacatatttcaactagccctcttatttgtttatttagcagtactcaca |
17116151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 221 - 297
Target Start/End: Original strand, 17117516 - 17117592
Alignment:
Q |
221 |
ccttttttctaccgtgcataattggttttggaagaagatccttggcgtaattgtttaatttgctctcatatttttcg |
297 |
Q |
|
|
||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
17117516 |
ccttttttctaccttgcataattgattttggaagaagatccttggcataattgtttaatttgctctcatatttttcg |
17117592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 62 - 166
Target Start/End: Original strand, 26649364 - 26649466
Alignment:
Q |
62 |
tttttgtttcccttttcgtgaaagcttctgcgatagcatcattctcattccaattttaaacttctgtgaaaagaatacatatttcaactagccttcttat |
161 |
Q |
|
|
||||||||||||||||| ||||| || | | ||||||||||||||||||||||| ||||| ||| | ||||||| || |||||||| ||| ||||| |
|
|
T |
26649364 |
tttttgtttcccttttcatgaaaactattttgctagcatcattctcattccaatttcaaact--tgttacaagaatatgtaattcaactaacctccttat |
26649461 |
T |
 |
Q |
162 |
ttgtt |
166 |
Q |
|
|
||||| |
|
|
T |
26649462 |
ttgtt |
26649466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University