View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0783-Insertion-14 (Length: 278)
Name: NF0783-Insertion-14
Description: NF0783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0783-Insertion-14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 8 - 259
Target Start/End: Original strand, 38366217 - 38366471
Alignment:
Q |
8 |
gtgacacaattcctcaaactcnnnnnnncgggcggaaaatgtatatttgaacatgattgtcacaccggccaacgcaacatttggaaaatcccggaagcta |
107 |
Q |
|
|
||||||||||||||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38366217 |
gtgacacaattcctcaaactctttttt-cgagcggaaaatgtatatttgaacatgcttgtcacaccggccaacgcaacatttggaaaatcccggaagcta |
38366315 |
T |
 |
Q |
108 |
ggaacgcgtcatcctttcttctaagaccatggaggcagaggagattgttgaacgatcaaagtgatttttagctaggagcaaagcgggatcttgtat---- |
203 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38366316 |
ggaacacgtcatcctttcttctaagaccatggaggcagaggagattgttgaacgatcaaagtgatttttagctaggagcaaagcgggatcttgtatgtac |
38366415 |
T |
 |
Q |
204 |
gtactatgaatgattttcaaactctttgatttgtattttgtcgcgatttagttagg |
259 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38366416 |
gtactatgaatgattttcaaactctttgatttgtattttgtcgcgatttagttagg |
38366471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 196 - 241
Target Start/End: Complemental strand, 2615842 - 2615797
Alignment:
Q |
196 |
tcttgtatgtactatgaatgattttcaaactctttgatttgtattt |
241 |
Q |
|
|
|||| |||||||||||||||||||| ||| ||||||||||||||| |
|
|
T |
2615842 |
tcttatatgtactatgaatgatttttaaatcctttgatttgtattt |
2615797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University