View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0783-Insertion-15 (Length: 157)
Name: NF0783-Insertion-15
Description: NF0783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0783-Insertion-15 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 8 - 157
Target Start/End: Complemental strand, 2221326 - 2221177
Alignment:
Q |
8 |
gagattacaaccaatcgctcccataccatcagatccaaaactcctccatgatgcctccgttgtattgctcttgtcccttgttcttcttgttgatgattat |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2221326 |
gagattacaaccaatcgctcccataccatcagatccaaaactcctccatgatgcctccgttgtattgctcttgtcccttgttcttcttgttgatgattat |
2221227 |
T |
 |
Q |
108 |
tgttgtctgttcttctccaccacttcacctcggatggccattgctgccta |
157 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2221226 |
tgttgtctgttcttctccaccacttcacctcggatggccattgctgccta |
2221177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 86
Target Start/End: Complemental strand, 38284527 - 38284449
Alignment:
Q |
8 |
gagattacaaccaatcgctcccataccatcagatccaaaactcctccatgatgcctccgttgtattgctcttgtccctt |
86 |
Q |
|
|
|||||||||||||| | |||||||||||||| ||||||| ||| |||||||||||||| ||| ||| |||| |||||| |
|
|
T |
38284527 |
gagattacaaccaaccactcccataccatcaaatccaaagctcatccatgatgcctccattgcgttgatcttttccctt |
38284449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University