View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0783-Insertion-15 (Length: 157)

Name: NF0783-Insertion-15
Description: NF0783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0783-Insertion-15
NF0783-Insertion-15
[»] chr3 (1 HSPs)
chr3 (8-157)||(2221177-2221326)
[»] chr7 (1 HSPs)
chr7 (8-86)||(38284449-38284527)


Alignment Details
Target: chr3 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 8 - 157
Target Start/End: Complemental strand, 2221326 - 2221177
Alignment:
8 gagattacaaccaatcgctcccataccatcagatccaaaactcctccatgatgcctccgttgtattgctcttgtcccttgttcttcttgttgatgattat 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2221326 gagattacaaccaatcgctcccataccatcagatccaaaactcctccatgatgcctccgttgtattgctcttgtcccttgttcttcttgttgatgattat 2221227  T
108 tgttgtctgttcttctccaccacttcacctcggatggccattgctgccta 157  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
2221226 tgttgtctgttcttctccaccacttcacctcggatggccattgctgccta 2221177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 39; Significance: 0.0000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 86
Target Start/End: Complemental strand, 38284527 - 38284449
Alignment:
8 gagattacaaccaatcgctcccataccatcagatccaaaactcctccatgatgcctccgttgtattgctcttgtccctt 86  Q
    |||||||||||||| | |||||||||||||| ||||||| ||| |||||||||||||| |||  ||| |||| ||||||    
38284527 gagattacaaccaaccactcccataccatcaaatccaaagctcatccatgatgcctccattgcgttgatcttttccctt 38284449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4657 times since January 2019
Visitors: 5751