View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0783-Insertion-9 (Length: 500)
Name: NF0783-Insertion-9
Description: NF0783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0783-Insertion-9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-128; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 8 - 292
Target Start/End: Complemental strand, 493806 - 493525
Alignment:
Q |
8 |
tgaaatggctctgt-aaatacaccatattggtggggtttaaccattggggggctaattagcaccggtgcacatggaagtacattgtggggtaaaggaagt |
106 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
493806 |
tgaaatggctctgccaaatacaccatattggtggggtttaaccattggtggcctaattagcactggtgcacatggaagtacattgtggggtaaaggaagt |
493707 |
T |
 |
Q |
107 |
gctgttcatgagtatgtaacacatattagaatagttagccctgcaggatgtgaagatggatatgctaaggttcgaaatcttaatgaatctcaccaagatc |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
493706 |
gctgttcatgagtatgtaacacatattagaatagttagccctgcaggatgtgaagatggatatgctaaggttcgaaatcttaatgaatctcatcaagatc |
493607 |
T |
 |
Q |
207 |
ttaatgcagcaagagtttctttaggggttcttggagttatttctcaggtatatatgcatgctccttttgttttgtatgtctagtag |
292 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
T |
493606 |
ttaatgcagccagagtttctttaggggttcttggagttatttctcagg----tatgcatgttccttttgttttgtatgtctagtag |
493525 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 319 - 500
Target Start/End: Complemental strand, 493500 - 493319
Alignment:
Q |
319 |
tcattgttttgggtatttaacatgatgtttgacttgtgtaacttactattttataggttaccttacaattggaacccctcttcaagcgatctattacgta |
418 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
T |
493500 |
tcattgttttgggtttttaacatgatgtttgacttgtgtaacttgctattttataggttaccttacaattggaacccctcttcaaacgatctcttacgta |
493401 |
T |
 |
Q |
419 |
tttgacaaaaaacgatactgatttgggtgatgaattgatcacttttggcaacaagcatgaatttgccgatgtaacatggtat |
500 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
T |
493400 |
tttgacaaaaaacgattctgatttgggtgatgaattgatcacttttggtaaaaagcatgaatttgccgatgtaacatggtat |
493319 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 71 - 123
Target Start/End: Original strand, 9063891 - 9063943
Alignment:
Q |
71 |
ggtgcacatggaagtacattgtggggtaaaggaagtgctgttcatgagtatgt |
123 |
Q |
|
|
||||| |||||||| ||||||| ||| ||||||||||| |||||||| ||||| |
|
|
T |
9063891 |
ggtgctcatggaagcacattgtcggggaaaggaagtgcggttcatgactatgt |
9063943 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University