View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0783_low_11 (Length: 304)
Name: NF0783_low_11
Description: NF0783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0783_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 85 - 221
Target Start/End: Complemental strand, 49117741 - 49117605
Alignment:
| Q |
85 |
attggtttgtttgtcattcgtgatatacttcctatattcaatctttggtgtaaactgagtatcctccgcgtgcaattgcggagattaatcattcgaattt |
184 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
49117741 |
attggtttgtttgtcattcatgatatactttctatattcaatcttcggtgtaaactgagtatcatccacgtgcaattgcggagattaatccttcaaattt |
49117642 |
T |
 |
| Q |
185 |
tacgggactttaatggacgacaaactctttcaaagag |
221 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49117641 |
tatgggactttaatggacgacaaactctttcaaagag |
49117605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 49117774 - 49117738
Alignment:
| Q |
1 |
tcacgtcatgtgttccgctctcaaccattatttattg |
37 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49117774 |
tcacgtcatgtgttccgctctcaaccattttttattg |
49117738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 295
Target Start/End: Complemental strand, 49117544 - 49117514
Alignment:
| Q |
265 |
ttgtgacacgcaagacttcctcaagtataat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
49117544 |
ttgtgacacgcaagacttcctcaagtataat |
49117514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 242 - 271
Target Start/End: Complemental strand, 49117581 - 49117552
Alignment:
| Q |
242 |
aaatatgtaattgtgcctaaattttgtgac |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49117581 |
aaatatgtaattgtgcctaaattttgtgac |
49117552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 132 - 174
Target Start/End: Complemental strand, 28665253 - 28665211
Alignment:
| Q |
132 |
gtgtaaactgagtatcctccgcgtgcaattgcggagattaatc |
174 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
28665253 |
gtgtaaactgggtatcctccgcgtgcaactgcggagactaatc |
28665211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University