View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0783_low_12 (Length: 283)
Name: NF0783_low_12
Description: NF0783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0783_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 88 - 181
Target Start/End: Original strand, 1000257 - 1000350
Alignment:
Q |
88 |
aaatattactcctataatcaggtctaacggatatggagctagactactacaacaccataatgtaatgatctaaaattcagaacttagagaagaa |
181 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1000257 |
aaatattactcctataatcaggtctaacggatatggagctagactactacaacaccataatgtaatgatctaaaattcagaacttagagaagaa |
1000350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University