View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0783_low_7 (Length: 400)
Name: NF0783_low_7
Description: NF0783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0783_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 2e-25; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 91 - 166
Target Start/End: Complemental strand, 5181551 - 5181476
Alignment:
| Q |
91 |
aaattggtatgggaatatgattaagatgtcatttactcattgaagtcggcatactatcgcgtcaaagaggaaatgg |
166 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5181551 |
aaattggtatgggaatatgataaagatggcatttactcattgaagtcggcaacctatcgcgtcaaagaggaaatgg |
5181476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 87 - 165
Target Start/End: Complemental strand, 5159327 - 5159249
Alignment:
| Q |
87 |
tgacaaattggtatgggaatatgattaagatgtcatttactcattgaagtcggcatactatcgcgtcaaagaggaaatg |
165 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||| |||| |||||||||||||||| ||||| |
|
|
| T |
5159327 |
tgacaaattggtatgggaatatgataaagatggcatttactcattgaagttggcaacctatcgcgtcaaagagaaaatg |
5159249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 115 - 166
Target Start/End: Complemental strand, 5194882 - 5194831
Alignment:
| Q |
115 |
gatgtcatttactcattgaagtcggcatactatcgcgtcaaagaggaaatgg |
166 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5194882 |
gatggcatttactcattgaagtcggcatactatcgcgtcaaagaggaaatgg |
5194831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 104 - 165
Target Start/End: Original strand, 4843278 - 4843339
Alignment:
| Q |
104 |
aatatgattaagatgtcatttactcattgaagtcggcatactatcgcgtcaaagaggaaatg |
165 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
4843278 |
aatatgataaagatggcatttactcattgaagtcggcaaactatcgcgtcaaagagaaaatg |
4843339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 167 - 205
Target Start/End: Original strand, 4843423 - 4843461
Alignment:
| Q |
167 |
aaagagtattatgtggagagtgacaaaacatattttttc |
205 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
4843423 |
aaagagtattatgtggagagtggcaaaccatattttttc |
4843461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 167 - 201
Target Start/End: Complemental strand, 5172136 - 5172102
Alignment:
| Q |
167 |
aaagagtattatgtggagagtgacaaaacatattt |
201 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
5172136 |
aaagagtattatgtggagagtggcaaaacatattt |
5172102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University