View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784-Insertion-12 (Length: 294)
Name: NF0784-Insertion-12
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784-Insertion-12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 11 - 161
Target Start/End: Original strand, 8039615 - 8039762
Alignment:
Q |
11 |
taaacatgatcacacactaaaatatatgccccgtatggcttagtgtgtttttgttcttgatttagactagttcgttgaatgtaaaatgacattgtttaga |
110 |
Q |
|
|
||||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8039615 |
taaacatgatcacacactaaaatatgt--cccatatggcttagtgtgtttttgttcttgatttagactagttcgttgaatgtaaaatgacattgtttaga |
8039712 |
T |
 |
Q |
111 |
tacattcacacaaaacttaattgtccagcctattttgagaggcaaaatcac |
161 |
Q |
|
|
|||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
T |
8039713 |
tacattcacacaaaccttaattgtccagccta-tttgagaggcaaaatcac |
8039762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 11 - 161
Target Start/End: Original strand, 8027501 - 8027648
Alignment:
Q |
11 |
taaacatgatcacacactaaaatatatgccccgtatggcttagtgtgtttttgttcttgatttagactagttcgttgaatgtaaaatgacattgtttaga |
110 |
Q |
|
|
||||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||||| |
|
|
T |
8027501 |
taaacatgatcacacactaaaatatgt--cccatatggcttagtgtgtttttgttcttgatttagattagttagttgaatgtaaaatgacatcgtttaga |
8027598 |
T |
 |
Q |
111 |
tacattcacacaaaacttaattgtccagcctattttgagaggcaaaatcac |
161 |
Q |
|
|
|||||||||| ||||||||||||||||||| | ||||||||| |||||||| |
|
|
T |
8027599 |
tacattcacaaaaaacttaattgtccagcc-aatttgagagggaaaatcac |
8027648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 228 - 294
Target Start/End: Original strand, 8039828 - 8039895
Alignment:
Q |
228 |
atgattggatattt-cttaattgaagatagaatttgaaatttttgactcaataatttctttttacttg |
294 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||| ||||| |||||||||| |
|
|
T |
8039828 |
atgattggatattttcttaattgaagatagtatttgaaatttttgactcaacaatttatttttacttg |
8039895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University